Review




Structured Review

GenScript corporation single guide rna (sgrna) targets
Single Guide Rna (Sgrna) Targets, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna+%28sgrna%29+targets/pmc12168089-55-0-19?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
single guide rna (sgrna) targets - by Bioz Stars, 2026-06
90/100 stars

Images



Similar Products

86
Benchling Inc optimal single guide rna sgrna target sequences
Optimal Single Guide Rna Sgrna Target Sequences, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna+%28sgrna%29+targets/pm42167230-305-5-14?v=Benchling+Inc
Average 86 stars, based on 1 article reviews
optimal single guide rna sgrna target sequences - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Synthego Inc single guide rna sgrna sequences targeting fh
Single Guide Rna Sgrna Sequences Targeting Fh, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna+%28sgrna%29+targets/pm42082831-318-1-9?v=Synthego+Inc
Average 86 stars, based on 1 article reviews
single guide rna sgrna sequences targeting fh - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Benchling Inc vero cells single guide rna sgrna sequences targeting dhhc11
Vero Cells Single Guide Rna Sgrna Sequences Targeting Dhhc11, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna+%28sgrna%29+targets/pm41223056-376-4-21?v=Benchling+Inc
Average 86 stars, based on 1 article reviews
vero cells single guide rna sgrna sequences targeting dhhc11 - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

94
Addgene inc aavs1 targeting single guide rna sgrna
Aavs1 Targeting Single Guide Rna Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna+%28sgrna%29+targets/pmc12650717-106-7-18?v=Addgene+inc
Average 94 stars, based on 1 article reviews
aavs1 targeting single guide rna sgrna - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

86
Sangon Biotech single guide rna sgrna sequences targeting set8
Single Guide Rna Sgrna Sequences Targeting Set8, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna+%28sgrna%29+targets/pm41029392-75-1-11?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
single guide rna sgrna sequences targeting set8 - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

90
GenScript corporation single guide rna (sgrna) targets
Single Guide Rna (Sgrna) Targets, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna+%28sgrna%29+targets/pmc12168089-55-0-19?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
single guide rna (sgrna) targets - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Addgene inc plasmid expressing both cas9 and single-guide rna (sgrna) targeting the tcf4 exon 2
Plasmid Expressing Both Cas9 And Single Guide Rna (Sgrna) Targeting The Tcf4 Exon 2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna+%28sgrna%29+targets/pm40465262-38-1-22?v=Addgene+inc
Average 90 stars, based on 1 article reviews
plasmid expressing both cas9 and single-guide rna (sgrna) targeting the tcf4 exon 2 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Sangon Biotech single-guide rna (sgrna) targeting cd155
Elevated <t>CD155</t> expression in EVs from NSCLC cells and patient plasma compared with healthy individuals. (A) Western blotting analysis of CD155 in EVs isolated from NSCLC and control cell lines. (B) Flow cytometry analysis of CD155 and CD63 in EVs isolated from H1975 and BEAS‐2B cells. (C) Western blotting analysis of CD155 abundance in EVs from the plasma of patients with NSCLC and healthy individuals in three independent tests. (D) Quantitative assessment of the fold change in CD155 expression from panel C, normalized to whole protein. (E) CD155 expression in EVs isolated from plasma of patients with NSCLC (LUAD, n = 20; LUSC, n = 4) and healthy individuals ( n = 16) using ELISA. (F) ROC curve analysis of the diagnostic potential of EV‐CD155 in distinguishing patients with NSCLC from healthy individuals. (G) Pearson correlation analysis of CD155 expression in EVs and tumour size in patients with NSCLC ( n = 24). (H) IHC analysis for CD155 expression in NSCLC tissue microarrays. Left: IHC staining images of paired tumour tissues (TT) and adjacent tumour tissues (ATT) ( n = 35). Right: quantitative analysis of IHC intensity for CD155 ( n = 49). T1, T2, and T3 in the quantification data refer to the tumour stages defined by the TNM classification system of NSCLC.
Single Guide Rna (Sgrna) Targeting Cd155, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna+%28sgrna%29+targets/pmc12077270-79-10-18?v=Sangon+Biotech
Average 90 stars, based on 1 article reviews
single-guide rna (sgrna) targeting cd155 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Thermo Fisher synthetic single-guide rnas (sgrnas) targeting brf2
Elevated <t>CD155</t> expression in EVs from NSCLC cells and patient plasma compared with healthy individuals. (A) Western blotting analysis of CD155 in EVs isolated from NSCLC and control cell lines. (B) Flow cytometry analysis of CD155 and CD63 in EVs isolated from H1975 and BEAS‐2B cells. (C) Western blotting analysis of CD155 abundance in EVs from the plasma of patients with NSCLC and healthy individuals in three independent tests. (D) Quantitative assessment of the fold change in CD155 expression from panel C, normalized to whole protein. (E) CD155 expression in EVs isolated from plasma of patients with NSCLC (LUAD, n = 20; LUSC, n = 4) and healthy individuals ( n = 16) using ELISA. (F) ROC curve analysis of the diagnostic potential of EV‐CD155 in distinguishing patients with NSCLC from healthy individuals. (G) Pearson correlation analysis of CD155 expression in EVs and tumour size in patients with NSCLC ( n = 24). (H) IHC analysis for CD155 expression in NSCLC tissue microarrays. Left: IHC staining images of paired tumour tissues (TT) and adjacent tumour tissues (ATT) ( n = 35). Right: quantitative analysis of IHC intensity for CD155 ( n = 49). T1, T2, and T3 in the quantification data refer to the tumour stages defined by the TNM classification system of NSCLC.
Synthetic Single Guide Rnas (Sgrnas) Targeting Brf2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna+%28sgrna%29+targets/pm40229899-140-6-11?v=Thermo+Fisher
Average 90 stars, based on 1 article reviews
synthetic single-guide rnas (sgrnas) targeting brf2 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


Elevated CD155 expression in EVs from NSCLC cells and patient plasma compared with healthy individuals. (A) Western blotting analysis of CD155 in EVs isolated from NSCLC and control cell lines. (B) Flow cytometry analysis of CD155 and CD63 in EVs isolated from H1975 and BEAS‐2B cells. (C) Western blotting analysis of CD155 abundance in EVs from the plasma of patients with NSCLC and healthy individuals in three independent tests. (D) Quantitative assessment of the fold change in CD155 expression from panel C, normalized to whole protein. (E) CD155 expression in EVs isolated from plasma of patients with NSCLC (LUAD, n = 20; LUSC, n = 4) and healthy individuals ( n = 16) using ELISA. (F) ROC curve analysis of the diagnostic potential of EV‐CD155 in distinguishing patients with NSCLC from healthy individuals. (G) Pearson correlation analysis of CD155 expression in EVs and tumour size in patients with NSCLC ( n = 24). (H) IHC analysis for CD155 expression in NSCLC tissue microarrays. Left: IHC staining images of paired tumour tissues (TT) and adjacent tumour tissues (ATT) ( n = 35). Right: quantitative analysis of IHC intensity for CD155 ( n = 49). T1, T2, and T3 in the quantification data refer to the tumour stages defined by the TNM classification system of NSCLC.

Journal: Journal of Extracellular Vesicles

Article Title: Identification of a Biomarker Panel in Extracellular Vesicles Derived From Non‐Small Cell Lung Cancer (NSCLC) Through Proteomic Analysis and Machine Learning

doi: 10.1002/jev2.70078

Figure Lengend Snippet: Elevated CD155 expression in EVs from NSCLC cells and patient plasma compared with healthy individuals. (A) Western blotting analysis of CD155 in EVs isolated from NSCLC and control cell lines. (B) Flow cytometry analysis of CD155 and CD63 in EVs isolated from H1975 and BEAS‐2B cells. (C) Western blotting analysis of CD155 abundance in EVs from the plasma of patients with NSCLC and healthy individuals in three independent tests. (D) Quantitative assessment of the fold change in CD155 expression from panel C, normalized to whole protein. (E) CD155 expression in EVs isolated from plasma of patients with NSCLC (LUAD, n = 20; LUSC, n = 4) and healthy individuals ( n = 16) using ELISA. (F) ROC curve analysis of the diagnostic potential of EV‐CD155 in distinguishing patients with NSCLC from healthy individuals. (G) Pearson correlation analysis of CD155 expression in EVs and tumour size in patients with NSCLC ( n = 24). (H) IHC analysis for CD155 expression in NSCLC tissue microarrays. Left: IHC staining images of paired tumour tissues (TT) and adjacent tumour tissues (ATT) ( n = 35). Right: quantitative analysis of IHC intensity for CD155 ( n = 49). T1, T2, and T3 in the quantification data refer to the tumour stages defined by the TNM classification system of NSCLC.

Article Snippet: For CD155 gene knockout (KO), a single‐guide RNA (sgRNA) targeting CD155 (human CD155 sgRNA: 5′‐CACCGCTGTTCGTCACGTTCCCGCA‐3′, 5′‐AAACTGCGGGAACGTGACGAACAGC‐3′) synthesized by Sangon Biotech (Beijing, China) and cloned into the lentiCRISPRv2 vector (Addgene, #52961).

Techniques: Expressing, Clinical Proteomics, Western Blot, Isolation, Control, Flow Cytometry, Enzyme-linked Immunosorbent Assay, Diagnostic Assay, Immunohistochemistry

Cellular origin and membrane localization of CD155 in EVs. (A) Immunofluorescence analysis of H1975 cells showing CD155 displayed higher co‐localization with CD63 and Rab5 than Rab7. Nuclei were stained with DAPI. Scale bars: 10 µm. (B) Quantitative analysis of Pearson's correlation coefficients demonstrating the co‐localization between CD155 with CD63, Rab5, and Rab7 in H1975 cells. (C) Western blotting analysis of cellular and EV CD155 treated with different endoglycosidases. PNGase F effectively removes the oligosaccharide chains of CD155, whereas these chains are resistant to Endo H cleavage. (D) Representative iEM images of EVs isolated from H1975 and BEAS‐2B cells. EVs were stained with anti‐CD155 antibodies. Scale bars: 100 nm. (E) Western blotting analysis of the immunocaptured EVs derived from H1975 cells using antibody against CD63 or CD155. (F) Representative iEM images of plasma EVs demonstrating CD155 localized on the EV membrane rather than within the lumen. Scale bars: 100 nm.

Journal: Journal of Extracellular Vesicles

Article Title: Identification of a Biomarker Panel in Extracellular Vesicles Derived From Non‐Small Cell Lung Cancer (NSCLC) Through Proteomic Analysis and Machine Learning

doi: 10.1002/jev2.70078

Figure Lengend Snippet: Cellular origin and membrane localization of CD155 in EVs. (A) Immunofluorescence analysis of H1975 cells showing CD155 displayed higher co‐localization with CD63 and Rab5 than Rab7. Nuclei were stained with DAPI. Scale bars: 10 µm. (B) Quantitative analysis of Pearson's correlation coefficients demonstrating the co‐localization between CD155 with CD63, Rab5, and Rab7 in H1975 cells. (C) Western blotting analysis of cellular and EV CD155 treated with different endoglycosidases. PNGase F effectively removes the oligosaccharide chains of CD155, whereas these chains are resistant to Endo H cleavage. (D) Representative iEM images of EVs isolated from H1975 and BEAS‐2B cells. EVs were stained with anti‐CD155 antibodies. Scale bars: 100 nm. (E) Western blotting analysis of the immunocaptured EVs derived from H1975 cells using antibody against CD63 or CD155. (F) Representative iEM images of plasma EVs demonstrating CD155 localized on the EV membrane rather than within the lumen. Scale bars: 100 nm.

Article Snippet: For CD155 gene knockout (KO), a single‐guide RNA (sgRNA) targeting CD155 (human CD155 sgRNA: 5′‐CACCGCTGTTCGTCACGTTCCCGCA‐3′, 5′‐AAACTGCGGGAACGTGACGAACAGC‐3′) synthesized by Sangon Biotech (Beijing, China) and cloned into the lentiCRISPRv2 vector (Addgene, #52961).

Techniques: Membrane, Immunofluorescence, Staining, Western Blot, Isolation, Derivative Assay, Clinical Proteomics